General Introduction

Established in 2013, the Pharmaceutical Nanotechnology and Drug Manufacturing Laboratory serves as an advanced scientific platform dedicated to developing and studying nanostructures as well as evaluating chemical compounds and their effects on the human body. The laboratory integrates principles from chemistry, pharmacy, and biomedical engineering to develop innovative solutions that enhance human health and improve quality of life.

Vision

The laboratory aspires to become a leading center in developing innovative technologies that advance medical and health sciences by integrating nanotechnology with modern chemistry, with the ultimate goal of improving human health and developing effective and sustainable treatments for challenging diseases.

Mission

Our mission is to create a research-driven environment that focuses on the design, synthesis, and evaluation of nanotechnology-based systems and chemical compounds with pharmaceutical relevance. We aim to support scientific innovation by developing advanced, safe, and effective therapeutic strategies while contributing to the education and training of future researchers in nanotechnology and medicinal chemistry.

  • Research Excellence: Conduct innovative research that expands scientific knowledge in nanotechnology and medicinal chemistry.
  • Improved Healthcare: Develop smart nanotechnology-based systems to enhance drug delivery and precisely target diseased cells.
  • Scientific Collaboration: Build strong partnerships with research and industrial institutions to exchange expertise and achieve shared scientific progress.
  • Sustainable Development: Produce environmentally safe and economically viable technologies that contribute to the development of modern therapies.
  • Training Qualified Researchers: Prepare the next generation of scientists through hands-on training in cutting-edge techniques in nanotechnology and medicinal chemistry.

The laboratory is equipped with a wide range of advanced tools and instruments, including:

  1. Hot Plate with Magnetic Stirrer LMS-1003
  2. PH Meter
  3. Micropipettes (variable volumes), CAPP
  4. ~Heating Mantel 250ml
  5. HEAT-ON 50ml INSERT (POLYMER COATED) For working with multi-well block holder, cat.# RR61020
  6. HEAT-ON 250 ML BLOCK FOR 3 NECK VESSELS POLYMER COATED , cat# RR61041
  7. Heat Gun, D26411, Dewalt
  8. Electronic Analytical Balance 220g , 0.1mg , ASB-220-C2
  9. Heidolph MR Hei- Tec , cat. # 505-30080-00 , HEIDOLPH Germany Package. Including: MR Hei-Tec hot plate stirrer, Stainless Steel PT-1000 Temp sensor for controling temperature of medium support rod & clamp
  10. RO UV Lamp
  11. Digital packed thermometer with prop -80 °C -- 250 °C
  12. orbital shaker with flat platform IPP4 biosan BIS-PSU-2T
  13. Hettich Universal 320 Centrifuge
  14. ~Diaphragm Vacuum Pump
  15. ~Oven,Memmert,Germaney,UNB400,53 liter
  16. Heidolph, Vortex Reax top
  17. Shaker
  18. Rotary Evaporator
  19. Melting point apparatus
  20. Oil-Based Vacuum, Two Stage, 3082-00, Welch
  21. Rotary evaporator complete with glass set , RE400, Bibby/Stuart/UK
  22. H2O Pro Arium Pro DI water Purification system, Sartorius
  23. Digital Ultrasonic Bath, Elmasonic-Germany S100(H)
  24. Dissolution apparatus Tester 6 places MRC-Israel , model DISS-06
  25. Refrigerator, COOL-Lab
  26. Heat Exchanger
  27. Rotary Evaporator ROVA- 100
  28. Digital Ultrasonic Bath+heater basket and cover , 9Litre , DC-200H
  29. Recirculating Chiller for Rotary Evaporator or Distillation Apparatus, 500w, LCB-R08
  30. Eloctronic Analytical Balance, Ohaus model: AR0640
  31. Digital Tablet Disintegration Test Apparatus (2 basket each basket contains 6 tube)
  32. Digital Water Bath for Rotary evaporator , RE400DB
  33. WATER BATH 22L
  34. فرن Multe Stage
  35. VARIO Chemistry Pumping Unit PC 3003 VARIO Select , Code No. 20738450
  36. DSC- Q200
  37. Atomic Force Microscope: CoreAFM , code No. BT07158, Nanosurf AG , Switzerland
  38. betaCatenin upper primer: 5 TGCCAAGTGGGTGGTATAGAG3 , 50 nanomole
  39. JENWAY/UK 7315 Spectrophotometer

Researcher in medicinal chemistry and nanomedicine, focusing on pharmaceutical nanotechnology, functionalization of nanomaterials (carbon nanotubes, gold nanoparticles, graphene), and organic synthesis for medical applications.

Researcher in synthetic medicinal chemistry, pharmaceutical chemistry, and anticancer drug design.

Expert in synthesizing new pharmaceutical molecules and analytical method development, with extensive experience in chemical manufacturing using microwave and flash chromatography.

  1. Design and Investigation of Novel Nanocarriers for Alzheimer Disease
  2. Synthesis of Carbon Nanodots for Targeted Photodynamic Therapy of Cancer Cells
  3. Exosomes derived formulations for Wound Healing
  4. Design and Investigation of Micro and Nano Particulate based Formulations for Cosmoceutical Applications
  5. The Development of Essential Oil Nanoemulsion as an effective Antimicrobial Agent
  6. Synthesis of Carbon Nanodots as a Novel Antibacterial Approach
  7. The development of Transethosomal System for effective Antifungal Activity
  8. The Development of Targeted Nanosystem with Carbon Nanodots
  9. Synthesis of valproic acid derivatives as promising anticancer
  1. Qatar University
  2. Technical University Dortmund
  3. University Medical Center Göttingen
  4. Beit Jala Pharmaceutical Company
  5. Gazi University
  6. University of Warsaw

The laboratory offers exceptional opportunities for students and researchers to develop both scientific and practical skills in conducting bachelor’s, master’s, and PhD research projects in pharmaceutical sciences and advanced related fields. It aims to prepare a new generation of highly skilled researchers capable of addressing scientific challenges, advancing medical and health solutions, and supporting graduation projects through access to resources and scientific supervision.

Location: Pharmacy Building (19B2020 & 19B2040), Faculty of Pharmacy,
An-Najah National University

Email: [email protected]