General Introduction
Established in 2013, the Pharmaceutical Nanotechnology and Drug Manufacturing Laboratory serves as an advanced scientific platform dedicated to developing and studying nanostructures as well as evaluating chemical compounds and their effects on the human body. The laboratory integrates principles from chemistry, pharmacy, and biomedical engineering to develop innovative solutions that enhance human health and improve quality of life.
Vision
The laboratory aspires to become a leading center in developing innovative technologies that advance medical and health sciences by integrating nanotechnology with modern chemistry, with the ultimate goal of improving human health and developing effective and sustainable treatments for challenging diseases.
Mission
Our mission is to create a research-driven environment that focuses on the design, synthesis, and evaluation of nanotechnology-based systems and chemical compounds with pharmaceutical relevance. We aim to support scientific innovation by developing advanced, safe, and effective therapeutic strategies while contributing to the education and training of future researchers in nanotechnology and medicinal chemistry.
- Research Excellence: Conduct innovative research that expands scientific knowledge in nanotechnology and medicinal chemistry.
- Improved Healthcare: Develop smart nanotechnology-based systems to enhance drug delivery and precisely target diseased cells.
- Scientific Collaboration: Build strong partnerships with research and industrial institutions to exchange expertise and achieve shared scientific progress.
- Sustainable Development: Produce environmentally safe and economically viable technologies that contribute to the development of modern therapies.
- Training Qualified Researchers: Prepare the next generation of scientists through hands-on training in cutting-edge techniques in nanotechnology and medicinal chemistry.
The laboratory is equipped with a wide range of advanced tools and instruments, including:
- Hot Plate with Magnetic Stirrer LMS-1003
- PH Meter
- Micropipettes (variable volumes), CAPP
- ~Heating Mantel 250ml
- HEAT-ON 50ml INSERT (POLYMER COATED) For working with multi-well block holder, cat.# RR61020
- HEAT-ON 250 ML BLOCK FOR 3 NECK VESSELS POLYMER COATED , cat# RR61041
- Heat Gun, D26411, Dewalt
- Electronic Analytical Balance 220g , 0.1mg , ASB-220-C2
- Heidolph MR Hei- Tec , cat. # 505-30080-00 , HEIDOLPH Germany Package. Including: MR Hei-Tec hot plate stirrer, Stainless Steel PT-1000 Temp sensor for controling temperature of medium support rod & clamp
- RO UV Lamp
- Digital packed thermometer with prop -80 °C -- 250 °C
- orbital shaker with flat platform IPP4 biosan BIS-PSU-2T
- Hettich Universal 320 Centrifuge
- ~Diaphragm Vacuum Pump
- ~Oven,Memmert,Germaney,UNB400,53 liter
- Heidolph, Vortex Reax top
- Shaker
- Rotary Evaporator
- Melting point apparatus
- Oil-Based Vacuum, Two Stage, 3082-00, Welch
- Rotary evaporator complete with glass set , RE400, Bibby/Stuart/UK
- H2O Pro Arium Pro DI water Purification system, Sartorius
- Digital Ultrasonic Bath, Elmasonic-Germany S100(H)
- Dissolution apparatus Tester 6 places MRC-Israel , model DISS-06
- Refrigerator, COOL-Lab
- Heat Exchanger
- Rotary Evaporator ROVA- 100
- Digital Ultrasonic Bath+heater basket and cover , 9Litre , DC-200H
- Recirculating Chiller for Rotary Evaporator or Distillation Apparatus, 500w, LCB-R08
- Eloctronic Analytical Balance, Ohaus model: AR0640
- Digital Tablet Disintegration Test Apparatus (2 basket each basket contains 6 tube)
- Digital Water Bath for Rotary evaporator , RE400DB
- WATER BATH 22L
- فرن Multe Stage
- VARIO Chemistry Pumping Unit PC 3003 VARIO Select , Code No. 20738450
- DSC- Q200
- Atomic Force Microscope: CoreAFM , code No. BT07158, Nanosurf AG , Switzerland
- betaCatenin upper primer: 5 TGCCAAGTGGGTGGTATAGAG3 , 50 nanomole
- JENWAY/UK 7315 Spectrophotometer
Researcher in medicinal chemistry and nanomedicine, focusing on pharmaceutical nanotechnology, functionalization of nanomaterials (carbon nanotubes, gold nanoparticles, graphene), and organic synthesis for medical applications.
Researcher in synthetic medicinal chemistry, pharmaceutical chemistry, and anticancer drug design.
Expert in synthesizing new pharmaceutical molecules and analytical method development, with extensive experience in chemical manufacturing using microwave and flash chromatography.
- Synthesis of curcumin derivatives for effective cancer therapy
- Development of nano-vesicles for targeted delivery to cancer cells
- Formation of nanomicelles for brain-targeted nasal drug delivery
- Synthesis of valproic acid analogs as novel anticancer agents
- Analytical method development for acetone and its derivatives through chemical derivatization
- Synthesis of indomethacin derivatives as selective COX-2 inhibitors
- Keto-ester benzodioxole derivatives as AMPA receptor antagonists
- Isoxazole derivatives as anticancer agents
- Trifluoromethcarboxamide derivatives as anti-tumor compounds
- Qatar University
- Technical University Dortmund
- University Medical Center Göttingen
- Beit Jala Pharmaceutical Company
- Gazi University
- University of Warsaw
The laboratory offers exceptional opportunities for students and researchers to develop both scientific and practical skills in conducting bachelor’s, master’s, and PhD research projects in pharmaceutical sciences and advanced related fields. It aims to prepare a new generation of highly skilled researchers capable of addressing scientific challenges, advancing medical and health solutions, and supporting graduation projects through access to resources and scientific supervision.
Location: Pharmacy Building (19B2020 & 19B2040), Faculty of Pharmacy,
An-Najah National University
Email: [email protected]